Evolution is a joke Pt. VIII

So you think it uncommon for yeast to “stick” together after being shaken vigorously in a bottle and should be concluded as descent with modification even though it’s still yeast? Is this correct? If pond scum groups together – that also is evolution? How about grass blades?

Thank you for the entertainment!

 

http://en.wikipedia.org/wiki/Dominance_(genetics)#Chromosomes.2C_genes.2C_and_alleles

So, per the link – I still am right. What I was stating is that per evolution with the squirrel, that the prior gene sequences we there, but no longer presented. I was not talking about allele’s since that is not how evolution works, but genetic drift (as I gave my example). If you just take the time to Google “recessive genes” in scholar, you’ll find all the information you are not understanding… and just to let you know – most people in discussions say genes. Alleles are only the radio in the car if the car is gene’s, which it is. Therefore, it is quite easy to say “Your car is jacked up!”, but it would be more proper to say, “Your car is jacked up because your steering is shot, and you have flat tires…” The car is the gene, and the variations (alleles) are what make up the car, like types of tires, radio and color of the seats….

Sheesh… can you ever admit you being wrong? Ever? You’ve already contradicted yourself twice, which I caught and said nothing until you started all this crap over and over and over…

About saying genes are not dormant or recessive or active. What happens when a whole gene is not “working” per say… What is that called? Because dealing with the squirrel situation that I was discussing, what the squirrel was prior to being a squirrel was (we’ll say some sort of lizard-squirrel) completely different. Now, those cars (not eye color and bucket seats), have went where? Are they dormant? Inactive?

If you think you know so much, what happens to the genes that are no longer present after a lifeform evolves? I have a couple websites on this, and have posted them before, but would love to hear your terminology for how whole chromosomes are changed and what happens when they are present, but not represented in the lifeform…

I’ll be waiting patiently…

 

Trying to use a car as an analog for a gene is ridiculous. You could use it as an organism, with each part being genes and the brands being alleles, but saying a radio is an allele in the car gene is idiotic. It really is. Alleles do not combine to make a gene. Alleles are variations of a gene. If you insist on using a car as an analogy for a gene, then your alleles would be make/model combinations.

And if you're only talking about genes, not individual alleles, why does every single link you reference about dominance mention only alleles and not genes? Look, you are using the term "recessive gene" incorrectly. If you search for that term on Google every single credible result will give examples of alleles. By all means, though, try to prove your point. All you have to do is name one gene (including all of its alleles) that is covered up by another, separate gene. Just one. That's all it takes to prove you're right. You said we know recessive genes exist, in the way that you're trying to use the term. You should be able to produce an example if you're right. By the way, don't come back here with something like the lac-operon genes. Those genes are affected by other genes, but they aren't masked. They are regulated, not recessive or dormant.

Please, quote my posts that are supposedly contradictory. Then I will show you how you're completely misunderstanding either my post or the relevant biological concepts in general. If they're the ones you already posted, then please reread my explanation for them.

I didn't say genes are not dormant. I said they aren't recessive. Alleles are recessive. The thing you're describing is dormant. That's what I've been saying all along. Dormant and recessive are not the same thing. That's my whole point. You keep saying "recessive gene," when you really mean dormant gene. But because you say "recessive" you then seem to expect a dormant gene to act like a recessive allele. They don't. They can't. They aren't the same thing.

They're dormant or mutated. They aren't recessive. Something is only recessive if it is covered up or masked. There is no gene in a snake that is covering up the genes for legs. Their leg genes are either dormant or have mutated to code for another trait. Again, if you're right, then it should be easy to produce an example of an entire gene, not just an allele, that is covered up by another separate gene, not just one of its own alleles.

 

I know what they are… If the gene is the car in the whole the variation in all cars are guess what? Radios… leather interior… It was so elementary Burzmali… Really? You think that when you get a car the “variation” you add to it or subtract aren’t a good example to a car being a gene and the options being variations of that car? Thus, you can have someone with the same car but completely different due to the variations one can add?

That’s fine… I’ll try to to be WAY more simplistic for you in the next time…

No… gene and allele are interchangeable. What are alleles and what are genes? Isn’t an allele a gene (variation)…? No? Are alleles made up of something other than what a gene is? You talk like they are apples and amoeba’s.

Also, I already did within the links and the example I gave… What is it called when a gene is not “dominant” that a whole gene is not… there are several diseases that this follows along. And other “inactivity” that happens when a gene isn’t present…

So, since you don’t know – here you go… http://en.wikipedia.org/wiki/Quantitative_trait_locus

It’s when you got sloppy remember? I know you remember – only a couple pages back…

I know dormant and recessive are not the same things… I think that is why it’s in “quotes”! And if you think they don’t, as alleles are made up of different stuff, then explain to us all what it is called after a species, like the squirrel evolves into a different species the DNA that is left over in its sequences?

You are correct, did the squirrel have legs previously? Are they the same legs? What about birds, did they have wings from when they were fish? How about feathers? In mutations that is… Mutations can either be recessive or dominant. http://www.ucl.ac.uk/~sjjgsca/DNAmutation.html
Do you understand? No… since we were talking about changing of the squirrel – read:

A mutation in the DNA by definition alters the genotype of the individual, however it may not affect the phenotype (ie it may or may not have a functional effect)
Mutations can either be recessive or dominant.
If a mutation simply inactivates a protein it generally results in recessive trait. Since we have a pair of chromosomes each carrying a copy of the genes, the non mutated gene can compensate for the mutated gene. Only when both chromosomes contain the mutation will the phenotype be affected.
If the mutation results in a protein that is toxic than the other gene on the other chromosome cannot counteract the mutation, such mutation is said to be dominant.
Dominat and recessive mutations result in different patterns of inheritance. In dominant mutation every individual with the mutated gene will have a mutated phenotype. In a recessive mutation , individuals with only one mutated gene will have a normal phenotype but are said to be carrier of the mutation. When two carrier individuals have children those that will have inherited mutated genes from both the mother and father will display the mutated phenotype.

http://en.wikipedia.org/wiki/Human_genome
In the most straightforward cases, the disorder can be associated with variation in a single gene.

http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/M/Mutations.html
How can we measure the frequency at which phenotype-altering mutations occur? In humans, it is not easy.
• First we must be sure that the mutation is newly-arisen. (Some populations have high frequencies of a particular mutation, not because the gene is especially susceptible, but because it has been passed down through the generations from a early "founder". [Link to an example]).
• Recessive mutations (most of them are) will not be seen except on the rare occasions that both parents contribute a mutation at the same locus to their child.
• This leaves us with estimating mutation frequencies for genes that are inherited as
o autosomal dominants
o X-linked recessives; that is, recessives on the X chromosome which will be expressed in males because they inherit only one X chromosome.
So if you have something better to explain how a fish turned into a squirrel, I am ALL EYES!!

Your knowledge is limited. As I stated I posted that for a reason to see (someone that was not you) their knowledge and you decided to jump in. I am right... again... you are wrong and will stick with your wrongness to the bitter end and just leave this thread.

Since evolution cannot explain where these genes go and how inactive sequences are then, some just there, but others not through mutation, but masked gene sequences..

Read this book... http://www.jstor.org/stable/75921

 

Here are some more links:

http://en.wikipedia.org/wiki/Phenotype

Because that right there is evolution and has nothing to do with alleles....

 

Look, I'm sick of going back and forth with you on this. I have two questions for you that will prove, without a doubt, whether you have any idea what you're talking about or not. If you'll kindly answer these two questions correctly, in your own words, I promise to never, ever correct you in one of your evolution threads ever again.

First, ignoring plasmids, how many different alleles for the same gene can be found in the genome of a single E. coli cell?

Second, if the following snippet of DNA is the initial part of a gene with no introns, what is the mRNA sequence that coincides with it?

Code:

5'-ACGTCGGATGCCCGGACCAGTTTTCCGGAGTCTA
3'-TGCAGCCTACGGGCCAGGTCAAAAGGCCTCAGAT

By the way, I just made up that sequence. So don't try googling it to get an answer.

 

Forgot this part eh?

"Each strain had evolved to be truly multicellular, displaying all the tendencies associated with “higher” forms of life: a division of labor between specialized cells, juvenile and adult life stages, and multicellular offspring."

Go figure

 

It's still the same yeast r199... Did it ever say it was different than what is was? Nope...

Did it say that it was not a multicellular lifeform? Nope...

All it said was that it as a bunch of yeast sticking together... That's it. And that is a "tendency" of higher forms of life, well... That's fantastic... When it BECOMES a higher form of life...


let me know...

 

What the hell happened to my last post?!?!? Oh well…

Not going to Google it…

First off Burz… from what I remember a cell is a living organism by itself… You need to be specific when you say “A single E. Coli Cell” since, from what I remember E. Coli is a living organism… What the heck are you talking about when you say “how many different alleles for the same gene can be found in the genome of a single E. coli cell.”?

Next answer…

mRNA is usually AUG or is it ATG isn’t is? I’m going off memory… I just know that when dealing with mRNA it has to be specific since it’s start codon… dang it… I think you got me… But, it’s memory… Haven’t been in school for a while, but what I DO remember is this!!!!

YOUR TURN – translate this:

Top strand:
AAATCCGAGCAATGGCTAGGTACTATGTATGAGATCATGATCTTTACAAA

The sequence is?

I guess the whole cell thing was you getting sloppy yet again…
Just had to make sure – I was right: http://en.wikipedia.org/wiki/Cell_(biology)

Forget it… Don’t answer… I’m not going to play this memory game anymore… The subject is Evolution… You f’ed up twice already and now feel the need to redeem yourself with irrelevant questions about DNA sequences…

I could care less… Unless you “tie” that into the topic I will flag it for being off topic. Because it is. I believe if you want to continue giving me a SAT dealing with biology – start a thread, PM me and I’ll be there. I always love a good challenge! But, that is not this subject!! We are discussing evolution Burz. You were wrong and feel the need to redeem yourself and not SAY your wrong – OOH NO… Never that…

Redeem away, but if you can’t go back to:

I know about recessive alleles, we are talking about WHOLE TRAITS such as legs to fins… Those are not alleles, but gene sequences! If you want to say different then say so.

It’s not a contest on who know more about gene sequences… I could care less, off of memory – you know what? You win… You win Burz… Does that help your internet ego? Feel better about yourself? If we sat down and got quizzed, I think I would win dealing with Biology on a whole, you are sloppy as you said and need the internet as a backing. Not me. All brain my friend. But, since I want to stay on topic… You win.

Happy?

Now answer how you can go from fins to legs dealing with gene sequences and chromosomes... Remember - as you stated, they can't be recessive...

 

The whole point is you don't know what you're talking about, and that's why you have unreasonable expectations about what should happen as part of evolution. You think "recessive genes" should behave in some particular way because you're thinking of alleles, not genes. You can't answer questions that would appear on a very simple microbiology test. Really, you're a biologist who can't remember that uracil always appears in RNA instead of thymine? Please. Stick to criticisms of evolution that don't involve genetics, whatsoever. Because you clearly have no idea what you're talking about when it comes to genes.

If you want something closer to what you were talking about, then produce one gene that is masked by another separate gene, rather than just one of its own alleles. That's all you have to do to prove you're right (which you aren't). Name one "recessive gene" and the gene that is "dominant" over it. Just one.

 

Sorry, but I don't remember everything biology. There are SEVERAL fields within biology Burz. I am in one of them and it deals nothing with nucleotides. Sorry... I don't google and what's this about uracil and thymine... I don't believe that was one of your questions.

And you didn't answer mine either... I know some off of memory... See how the game works? At least I didn't chicken out and didn't answer..

Answer my question Burz... What? You know nothing about genetics?

Fabulous!!! Your right Burz!!! Thank you for proving my point dealing with evolution!!!

Question then. Dealing with what the initial post was… Whatever the squirrel was before it was a squirrel. If that whole gene sequence of whole traits (like eyes, legs, hair, scales) was not covered up by a mutation of another group of genes… then…. How does evolution happen!!! Because in order for scales to turn into skin a mutation happens that creates skin right? But, that has to wait when two parents meet have babies. Not until both parents have the skin mutation does it go forward, but, the scale one is still there now isn’t it… so… if that scale gene sequence isn’t “covered up” by the dominant skin sequence… what the heck happens Burz? Oh – believe me… I’m with you!!! I think per what I know – it’s a bunch of crock and that was my initial point!!! BUT – since you wanted to jump in and take that person’s place – I will treat you as an intruder and thus… do as I have been…

So…. What happens?



OOOOH THE GENIUS OF IT ALL!!!! Some of you reading knew it was coming huh?!?! I pulled a Grasping!

 

You told me not to answer it and threatened to report my post. You want an answer all of a sudden? If so, which side is 5'? Are there introns? What sequence do you want, mRNA or amino acid? I asked you for a transcription and then you asked for a translation, so I can't tell which one you want.

I'm aware there are multiple subfields of biology, I had to learn about all of them in some regard to get my degree. Did they completely skip genetics, microbiology, and anatomy at your school? Uracil instead of thymine is part of the applied knowledge that would be necessary to determine the mRNA strand that results from a DNA sequence. It's like needing to know the difference between velocity and acceleration in order to do a physics problem. That's why "I can't remember" seems ridiculous as an excuse for why you don't know it. If you can't remember such a basic biological concept, why should anyone believe you when you bring up others in your criticism of evolution?

It's not covered up. It's dormant or mutated to serve another function. There is a monumental difference in the way recessive alleles behave versus dormant genes. A dormant gene will not simply reappear because another gene has also gone dormant. The dormant gene has to mutate again to become active. You seem to think that it should just reemerge like a recessive allele. You're expecting recessive behavior from something that is dormant. Huge difference. Furthermore, going from skin to scales takes way more than a single mutation in a single gene. This makes it even less likely that the old trait will reemerge.

You said we know that "recessive genes" exist. Then you went on to describe recessive allele behavior for an entire gene. Do you get that? For the last time, can you admit that entire genes cannot be recessive? If you're going to persist in claiming they can be, then produce one example. You said they exist. Give an example or admit you're wrong.

 

it went from single celled to multicell..Not the same.

 

I’ve been out of Japan for about 10 years, and can’t speak a word when I spoke it fluently. Say whatever Burz… It really doesn’t matter. Messenger RNA from what I remember is start codons… was I wrong? I don’t think so… Now, I’ve been out of school for 30 years…

I know that for a whole year each Friday we had a spelling test with 100 words on it and the only one I remember is trite… Which works well for your argument of me not remembering…

Aren’t allele’s genes… but genes are allele’s? Just wondering.. No I am not wanting something dormant to become active or whatever. What I am saying is this… There is a gene for eyeball. Then there is a mutation… that screws up that whole gene on the mom. What happens to that gene when it combines with poppa’s good eyeball gene?

I just want you to explain how a whole gene set, such as eyes or arms or whatever evolves. Since you just stated that, basically, it can’t happen… If there is a mutation on momma in the eyeball gene that turns it into an antennae (not in the alleles for color) and daddy has a good eye gene and they have little Tommy – with two good eyes… What happened to momma’s antennae gene when the chromos paired up?

 

It didn't go to multi-cellular!!! What the hell are you talking about!!! They stuck together... Like sugar...

Let me show you how retarded your Faith in that article for being right is just so wrong...

Flour... Okay you can have one molecule that equates to flour. Now, you go get a bag of flour - is that now a different breed of some multi-cellular lifeform?

You have a single grass blade... then the roots spread out and it grows and makes your front yard... Did that one grass blade EVOLVE into your yard?

Do you see how retarded that is? Do you...?

 

Do you even read what is presented?

 

"Messenger RNA ... is start codons," makes no sense. However you want to try to explain it away, it still looks like you don't know what you're talking about. If you can't remember this kind of stuff, then you should be staying away from it when you try to make an argument.

There isn't one gene for eyeball. There are genes for rods, and cones, and cornea, and iris, and optic nerve. There isn't a single gene that's responsible for the formation of the entire eye.

That has been explained before. I gave you an example of how a muscle might evolve into a tube heart, and how the flagella may have formed from a combination of other useful proteins. You ignored them. I'm not about to waste time on a third explanation.

Also, I didn't say anything that would prevent the evolution of a trait. I said a mutation in a single gene will not cause a major organ or limb to suddenly turn into another kind of organ or limb. The behavior you're describing is that of a single gene. Specifically, it's of alleles of a single gene. This is why your whole idea is wrong about "recessive genes" somehow being a problem for evolutionary theory.

Finally, since you've demonstrated that you can't remember how genes function, I want to encourage you again to simply drop this whole line of argument. It's like you're arguing about algebra but can't remember how to multiply.

 

No. But I see this thread is still going strong... Hey, did DBM ever disprove evolution, or are we still talking about the Hand Banana proof of ID?

Wait, nevermind. I see DBM still introducing facts like humans not sprouting antennae or wings or turning into grasshoppers as proof that evolution repeatedly witnessed in labs with fruit flies adapting to their environment over a short period (short lifespan, fast reproduction) doesn't actually happen.

Carry on.

 

Are you going to answer the question or not… It was a generalization… you know was…

Not really… what I did remember I posted and asked you to answer (which you didn’t). That’s fine. Please since you do not feel that mutations in genes cause major organs, how do you then explain complexity? Because you are not going to get it from mutations in alleles now are you? Also, when that mutation (for complexity) does occur and it happens in only one parent, when happens when they mate and the other partner does not have that mutation?

 

Almost forgot to answer this. Going off of memory… isn’t the codon the first sequence in RNA? If it’s not related to RNA then what is it related to… I can’t remember the specifics – so by all means enlighten us of how messenger RNA doesn’t have a start codon…

 

I know that fruit flies and all sorts of creatures and plant life "adapt"... I have never said anything about ADAPTING!! I know that life ADAPTS.

Now... we are talking about evolution... not adapting... I do hope you have learned the difference from the last time you took part in this discussion...

 

Fine... What did it turn into then? A fish? What... the article stated it turned into guess what?

A clump of yeast...



Imagine that....

 

I have an honest question for you: is English not your first language? The reason I ask is that a lot of your posts have strange wording and poor grammar. I'm not making any kind of judgment about you if English isn't your first language, I'd just like to know.

Regarding your posts above: why should I try to explain any of this to you after you have admitted to not knowing the biological concepts necessary for understanding the answers and you have a history of ignoring and/or forgetting past explanations? I've given two examples in the past of how traits/organs might have developed, and we argued for a couple of weeks about duplication-divergence as a mechanism for increasing complexity. I really don't feel like spending more time answering your questions when you can't understand them and you ignore/forget them.

 

It went from a single cell organism to a multicell organism. That is evolution.

I see why you cant fathom this. You seem to think a duck should turn into a dog in one generation.

 

Congrats: An adaptation in biology is a trait with a current functional role in the life history of an organism that is maintained and evolved by means of natural selection. An adaptation refers to both the current state of being adapted and to the dynamic evolutionary process that leads to the adaptation. Adaptations contribute to the fitness and survival of individuals.

http://en.wikipedia.org/wiki/Adaptive_Evolution

Natural selection is the gradual, nonrandom process by which biological traits become either more or less common in a population as a function of differential reproduction of their bearers. It is a key mechanism of evolution.

http://en.wikipedia.org/wiki/Evolution

Unfortunately, your view that adaptation is completely separate from evolution is wildly misguided. A simple Google search or reading a couple of pages on Wikipedia would have informed you otherwise, however, you've chosen not to inform yourself. It's abundantly clear that you don't understand the basic theory you're railing against, even though you seem to already agree with it.

I strongly suspect that if I were to take a bottle of Liquid Paper to a Bio 101 textbook, change "evolution" to "intelligent design" and re-title it "God's Process of Adaptive Creation," you would present it here as evidence to show evolution doesn't exist.